tripeptide raises a handful of sensible questions. This page answers them in order, starting with the fundamentals and moving to applications.
This page was last updated on 2026-03-13 and is reviewed periodically as new material appears.
Endogenous GHK occurs in blood plasma, saliva, and urine, and reported plasma concentrations decline with age in several studies. Researchers have proposed that the peptide acts as a copper carrier that delivers the metal to cells and to sites of injury. That transport role is a hypothesis supported by binding measurements and tissue-distribution data rather than a settled mechanism, and the peptide is generally described as a minor contributor to total plasma copper transport. Values reported in wound fluid and certain tissue extracts are higher than in circulating plasma.
The sequence carries three residues in the order glycine, histidine, lysine, which places a small, flexible chain around a single metal centre. Compared with larger copper-binding proteins, the complex is compact and its coordination chemistry can be reproduced with synthetic peptide in a laboratory. Published structural work agrees on the nitrogen donor set but differs in the exact geometry assigned under some conditions, so the arrangement is best treated as well characterised in outline rather than fixed in every detail.
GHK-Cu is a coordination complex formed between the tripeptide glycyl-L-histidyl-L-lysine and a copper(II) ion. The peptide was isolated from human plasma in the early 1970s by Loren Pickart, who observed that a plasma fraction from young donors stimulated growth in cultured liver cells. The copper-bound form is abbreviated GHK-Cu, while the metal-free peptide is written simply as GHK. In the research literature the complex also appears as copper tripeptide-1 and as glycyl-histidyl-lysine copper complex.
The International Nomenclature of Cosmetic Ingredients lists the substance as copper tripeptide-1, the name that appears on most topical product labels. Related designations include copper peptide and GHK-Cu, and the hyphenated form is common in research literature. In cosmetics the material is regulated as an ingredient rather than as a drug, so products may reach the market without evidence of the effects claimed for them. Whether those effects are clinically meaningful is an open question, since most supportive data come from laboratory work and small trials.
GHK-Cu is the copper complex of the tripeptide glycyl-L-histidyl-L-lysine, a short sequence found naturally in human plasma, saliva and urine. Loren Pickart reported the isolation of the free peptide in 1973 while studying factors that influenced the growth of aged liver cells in culture. The peptide was later shown to bind copper(II) with high affinity, and the metal-bound form became the focus of most subsequent research. Its concentration in circulation declines markedly with age, a pattern that is well documented, though the physiological consequences of that decline remain debated.
The peptide portion consists of three amino acids: glycine, histidine and lysine. Copper(II) coordinates through the imidazole nitrogen of histidine, the alpha-amino group of glycine and a deprotonated amide nitrogen of the backbone, producing a roughly square-planar geometry. This arrangement gives the complex its characteristic blue-to-violet colour and helps it resist dissociation in water. Reported stability constants are high, although values differ between studies because of differences in ionic strength and measurement method.
| Property | Value | Notes |
|---|---|---|
| Chemical class | Copper(II)-tripeptide complex | One peptide ligand with one coordinated metal centre |
| Peptide sequence | Gly-His-Lys | Three residues written in one-letter notation |
| Free peptide mass | 340.4 g/mol | Metal-free GHK; the complex has a higher mass |
| Appearance | Blue to violet solid or solution | Colour originates from copper d orbital transitions |
| Storage | Desiccated, -20 °C, protected from light | Dry powder is more stable than dissolved material |
Material described in research and cosmetic supply chains is typically a synthetic peptide supplied as a lyophilized powder. Purity is commonly reported through chromatographic separation, often at 95 percent or higher, while copper content is confirmed by separate elemental analysis. Batch variation in color and solubility can reflect residual counter-ions, moisture, or partial oxidation of the peptide. Because the complex is not a single regulatory entity, specifications differ between suppliers and are not standardized internationally.
GHK-Cu is a coordination complex formed between the tripeptide glycyl-L-histidyl-L-lysine and a copper(II) ion. The peptide binds copper through its histidine imidazole nitrogen, its terminal amino group, and a deprotonated amide nitrogen, creating a stable chelate ring. The resulting complex carries a distinctive blue to blue-violet color, which arises from copper d-d electronic transitions. In the solid state it is usually handled as a powder, while in solution the complex can dissociate and re-form depending on pH and competing ligands. The name copper tripeptide-1 is widely used in ingredient listings.
Several names circulate for the same material, which complicates literature searches. Cosmetic ingredient lists often use copper tripeptide-1, while older biochemistry papers use glycyl-L-histidyl-lysine or its abbreviation GHK. The copper complex is sometimes written as GHK-Cu(II) to make the oxidation state explicit. Terminology is not fully standardized, so matching a compound across sources requires attention to the exact sequence, the counterion, and the stated copper content. Reviews that compare studies must account for these naming differences before drawing conclusions.
GHK-Cu is the copper(II) complex of the tripeptide glycyl-L-histidyl-L-lysine, a short sequence of three amino acids. The peptide was first isolated from human plasma in 1973 during research on factors that influence tissue repair in liver. Its ability to bind copper ions became a central point of interest because the metal changes the peptide's chemistry and its behaviour in laboratory systems. Today the compound appears in cosmetic formulations, cell-culture studies, and biochemistry literature under several names.
The peptide sequence places a histidine in the middle, and this residue dominates metal binding. Copper(II) coordinates through the imidazole nitrogen of histidine and the terminal amino group, forming a stable chelate ring system. Loss of the copper ion leaves the free tripeptide, which has different solubility and reactivity. This structural detail matters because assays that measure only the peptide backbone can miss whether copper is still bound to it.
Published work on GHK-Cu concentrates largely on cell culture systems rather than whole organisms. Frequently used endpoints include collagen synthesis, expression of matrix metalloproteinases, and migration of fibroblasts. Some reports describe antioxidant behavior, while others stress delivery of copper into cells. These mechanisms are proposed rather than demonstrated, and the relative weight of each pathway is unclear. Human trials are few and generally small, so laboratory findings should not be read as confirmed clinical results.
GHK-Cu is a coordination complex formed between the tripeptide glycyl-L-histidyl-L-lysine and a copper(II) ion. The peptide backbone consists of glycine, histidine, and lysine joined in that order. Copper is held through the imidazole nitrogen of histidine and the alpha-amino group at the N-terminus, which together produce a square-planar arrangement around the metal center. The solid appears blue to violet, a color that originates from d-d electronic transitions within the copper coordination sphere. The complex is indexed under CAS number 89030-95-5.
The sequence now called GHK was first reported in the early 1970s after isolation from human plasma, where it was noted to influence liver cell behavior in laboratory preparations. Later work described a copper-binding form and its activity in fibroblast and wound-model experiments. Review articles frequently group the substance with other copper peptides. Concentrations in blood appear to fall with age in several small surveys, although the reason for this trend is not settled. Whether such a decline carries functional consequences remains an open question.
Several studies have shown that doxycycline inhibits dopaminergic neurodegeneration through the upregulation of axonal and synaptic proteins. Axonal degeneration and synaptic loss are key events at the early stages of neurodegeneration and precede neuronal death in neurodegenerative diseases, including Parkinson's disease (PD). Therefore, the regeneration of the axonal and synaptic network might be beneficial in PD. It has been demonstrated that doxycycline mimics nerve growth factor (NGF) signaling in PC12 cells. However, the involvement of this mechanism in the neuroprotective effect of doxycycline is unknown. Doxycycline is also studied in reverting inflammatory changes related to depression. While there is some research on the use of doxycycline for treating major depressive disorder, the results are mixed. After a large-scale trial showed no benefit of using doxycycline in treating COVID‑19, the UK's National Institute for Health and Care Excellence (NICE) updated its guidance to not recommend the medication for the treatment of COVID‑19. Doxycycline was expected to possess anti-inflammatory properties that could lessen the cytokine storm associated with a SARS-CoV-2 infection, but the trials did not demonstrate the expected benefit. Researchers also believed that doxycycline possesses anti-inflammatory and immunomodulatory effects that could reduce the production of cytokines in COVID-19, but these supposed effects failed to improve the outcome of COVID-19 treatment.
==== Responsiveness to ovarian steroids ==== Dimorphism is also found in physiological and behavioral responses to ovarian steroids in adults, where males and females respond to these hormones differently. For example, estrogen receptor sensitivity for different sets of neurons is dimorphic already early on in development. Hypothalamic dimorphism underlies some known behavioral differences in mice, and has known physiological effects in humans, e.g. affecting thermoregulation and metabolism. Although human hypothalami exhibit various sex differences, it is not certain which behaviors are caused, predisposed, and not caused by these. In addition to confounding environmental factors, the hypothalamus also contributes to dimorphic human behaviors where the hypothalamus does not itself cause dimorphism, but rather exhibits conditional, dimorphic responses as part of greater pathways, such as the HPG-axis or the HPA-axis. Estrogen and progesterone can influence gene expression in particular neurons or induce changes in cell membrane potential and kinase activation, leading to diverse non-genomic cellular functions. Estrogen and progesterone bind to their cognate nuclear hormone receptors, which translocate to the cell nucleus and interact with regions of DNA known as hormone response elements (HREs) or get tethered to another transcription factor's binding site. Estrogen receptor (ER) has been shown to transactivate other transcription factors in this manner, despite the absence of an estrogen response element (ERE) in the proximal promoter region of the gene.
=== Committee === WOSM's committee is its executive governing body, composed of elected volunteers and its secretary general, which is responsible for the implementation of the resolutions of its conference and governs the organization between meetings of its conference. The committee meets at least twice a year. Its steering committee, consisting of the chairperson, two vice-chairpersons and its youth advisor and secretary general meet as needed. The committee has 21 members. Twelve, each from a different country, are elected for three-year terms by WOSM's conference. The members, elected without regard to their nationality, represent the interests of the movement as a whole, not those of their country. The secretary general, the treasurer of WOSM and a representative member of the board of the World Scout Foundation and the chairpersons of the regional Scout committees are ex-officio members of the committee. From 2008 to 2021 six Youth Advisors to the WSC were elected by the World Scout Youth Forum. The Youth Advisors participated in all of the WSC meetings and were also part of the governing structure between the meetings. There will be no Youth Advisors from 2024. The 2021–2024 committee set up work streams to address the top strategic priorities, as defined by WOSM's conference. Task forces include:
=== Burnout prevention and balancing life === After his personal experience with burnout at the peak of his medical career, Maroon developed a strong interest in burnout prevention and living a more balanced life. He conducted extensive research into burnout, burnout prevention, and what constitutes a healthy, balanced, and successful life outside of a professional career. Maroon has given keynote presentations on this subject matter at national and international conferences. In 2017, he published the book Square One: A Simple Guide to a Balanced Life. In 2025, he was the keynote speaker at Focus Forward 2025 for the state of West Virginia, where he spoke on the topic "How to Die Young as Late as Possible." He has also participated in numerous interviews and seminars promoting healthy living and longevity.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
Sources: en.wikipedia.org
=== Act 2 === Lucinda, a runaway slave, rifles through the pockets of the dead chain gang prisoners. Inman regains consciousness and awakens, which startles her. Lucinda frees Inman, who resumes his journey. Back at Black Cove Farm, Stobrod and his traveling companion Pangle still rely upon Ruby and Ada for sustenance. Stobrod tries to convince Ruby that he is a changed man, but Ruby remains skeptical. Inman meets Sara, a war widow, who is trying to comfort her baby. Inman helps her, gains her trust, and is invited to spend the night. At Black Cove Farm, Teague appears, with a copy of the newspaper that lists the names of deserters, on which Ruby sees her father's name. The next morning, Inman and Sara react quickly when Union soldiers appear. At a campfire in the woods, Teague and his men confront Stobrod and Pangle, shoot them and leave them for dead. Ada finds the two men, and expresses compassion for Stobrod ("I feel sorry for you"). Ada later goes hunting in the woods. There, she and Inman reunite. The other characters whom Inman has encountered on his odyssey appear to Inman, and urge him to tell Ada about his adventures ("Tell her of the slave you met"; "Tell her how the boat went down"). The couple affirms their pledge to each other. Teague continues his pursuit. Ada and Inman consummate their love, on their final night together. Eventually, Teague and the Home Guard track down Inman. In the final battle, Inman is killed.
Stroganoff is also popular in Nordic countries. In Sweden, a common variant is Korv stroganoff (lit. 'sausage stroganoff'), which traditionally uses the local falukorv sausage as a substitute for the beef. In Finland, the dish is called makkarastroganoff (lit. 'sausage stroganoff'). Beef Stroganoff is, however, also a common dish in Finland. Diced brined pickles are also a normal ingredient in Finnish Stroganoff.
=== Proton nuclear magnetic resonance (NMR) === Also in chemistry, the term proton NMR refers to the observation of hydrogen-1 nuclei in (mostly organic) molecules by nuclear magnetic resonance. This method uses the quantized spin magnetic moment of the proton, which is due to its angular momentum (or spin), which in turn has a magnitude of one-half the reduced Planck constant. (
Believing that a deficiency in political theory was being filled by the entryist infiltration of the party by the Trotskyists (such as the Militant tendency), he thought the problem was better resolved by communist thinking from members of the CPGB. (He was later opposed to the expulsion of members of Militant.) In response, Denis Healey, Deputy Leader of the Labour Party, tried and failed to remove Galloway from the list of prospective parliamentary candidates. Healey lost his motion by 13 votes to five. Galloway once quipped that, to overcome a £1.5 million deficit which had arisen in Dundee's city budget, he, Ernie Ross, and leading councillors should be placed in the stocks in the city square: "We would allow people to throw buckets of water over us at 20p a time." In 1983, Galloway attempted to stand for the safe Labour seat of Rhondda after the Welsh Transport and General Workers' Union and the National Union of Miners had both nominated him to succeed Alec Jones, who had died. He hoped to be selected in the newly created seat of Dunfermline East, where no incumbent was standing. Galloway failed to be selected for either seat, with Rhondda selecting Allan Rogers, and Dunfermline East selecting future Chancellor of the Exchequer and later Prime Minister, Gordon Brown. Standing as a candidate for a place on the Labour Party National Executive Committee in 1986, in a large field of 18 candidates, Galloway finished in 16th place.
The word "juice" developed around the year 1300 from the Old French words jus, juis, jouis ("liquid obtained by boiling herbs"). The Old French jus ("juice, sap, liquid") (13c.) came from Latin ius ("broth, sauce, juice, soup"), from the Proto-Indo-European root *yeue- ("to blend, mix food") (cognates: Sanskrit yus "broth", Greek zyme "a leaven", Old Church Slavonic jucha "broth, soup", Russian: уха ukha, Lithuanian: juse "fish soup"). The use of the word "juice" to mean "the watery part of fruits or vegetables" was first recorded in the early 14th century. Since the 19th century, the term "juice" has also been used in a figurative sense (e.g., to mean alcohol or electricity). Today, "au jus" refers to meat served along with its own juice, commonly as a gravy.
Sources: en.wikipedia.org
It consists of a three-amino-acid peptide, glycine-histidine-lysine, bound to one copper(II) ion. The peptide supplies four nitrogen donor atoms, and the resulting complex is stable in neutral aqueous solution. The metal-free peptide is usually called GHK.
The three letters are the standard one-letter codes for glycine, histidine, and lysine. The suffix -Cu indicates the coordinated copper ion. Cosmetic ingredient lists often use the alternative name copper tripeptide-1 for the same complex.
No. Free GHK is the peptide alone, while GHK-Cu contains a bound copper atom. The two differ in colour, charge, and binding behaviour, so any study that measures copper delivery must state which form was used.
It is a complex of a three-amino-acid peptide, glycine, histidine and lysine, bound to a single copper(II) ion. The metal is held mainly by the histidine side chain and the peptide backbone. Most commercial material is supplied as an acetate salt rather than as the free complex.